Skip to Content
Merck
CN

CWA-1022

Sigma-Aldrich

Anti-Mouse CD80 (16-10A1) ColorWheel® Dye-Ready mAb

greener alternative

for use with ColorWheel® Dyes (Required, sold separately)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
12352203
NACRES:
NA.41

Product CWA-1022 is not currently sold in your country. Contact Technical Service

biological source

hamster

Quality Level

antibody form

purified antibody

antibody product type

primary antibodies

clone

16-10A1, monoclonal

product line

ColorWheel®

form

lyophilized

mol wt

calculated mol wt 34.59 kDa

species reactivity

mouse

packaging

antibody small pack of 25 μL

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU068661EMU051971EMU000381
esiRNA cDNA target sequence

GACTTCAGGAGCCGACTGAGGAAACTCTTCAGTTCCCACAGGTTTCAGGTCATCATCATCTGCCTGGTGGTCCTGGACGCCCTCCTCGTGCTTGCTGAACTCCTCCTGGATTTGAAGATCATCGAGCCGGACGAGCAAGACTATGCGGTCACGGCGTTCCACTACATGAGCTTTGCCATCCTGGTCTTCTTCATGTTGGAGATTTTTTTCAAGATCTTCGTCTTCCGCTTAGAGTTCTTCCACCACAAGTTTGAGATCCTGGATGCCTTCGTGGTGGTGGTGTCTTTCGTCCTTGACCTTGTCCTCTTGTTTAAAAGCCACCACTTCGAAGCTCTAGGGCTGCTGATCTTGCTTCGGCTCTGGAGGGTGGCCCGGATCATCAATGGCATCATCATCTCCGTGAAGACACGCTCAGAACGGCAGATCTTAAGGCTAAAGCAGATAAATATCCAACTGGCCACCA

esiRNA cDNA target sequence

ATTTTCGAGGTCACCCATCAGTTTGTGAAGTGCTGAACTGTCTGCCCGCAAACTTGCCTGTAAGAACTAAGGAGAGACACAGCGCCCTGAGCAGCAGTTCCCATGGAGGCTTCTCATCTCTGCTCTCCTAGCACCTGTACCAAGTCTGCATGCCAGGGTTTGCCGCAGTTCTAAGTCCCACCAATAAAGCCCCTGTTGGTGCCACAGTGCTGCGTGAAGGTGGTCTGAGAAATACTCCCTCCATTAATAAGATTGGACTCTGGAGGTCTTTGCTTTCTAATCCCTATTCTGTACCTGATCCAGTTTGCATGTGGCTTATATAAAGGCTCTCTATCTAGCTCTTAAGAAATAGGCAGGCCAGCCTCCAGGATCAAAGGCATGAAAGCACAAATGGCAGAGAATCCTATGGAGTGCTGCTGTGA

esiRNA cDNA target sequence

AGATTTGCCGTACCTTTCCACCACAGAAATGTATTTGTGTCGTTGGCACCAGCCTCCCCCATCACCGTTACCATTACGGGAATCCTCTCCAAAGAAGGAGGAGACTGTAGCAAGGTGTCTGATGCCATCAAGTGTTGCAGGAGAAACTTCAGTCTTGGCTGTTCCTTCTTGGAGGGACCACTCAGTAGAGCCTCTAAGGGACCCAAATCCTTCAGACATTTTGGAGAACCTGGATGACAGTGTATTTTCAAAGAGGCATGCAAAACTGGAGCTAGACGAGAAGAGGAGAAAACGATGGGATATTCAGAGGATCAGGGAACAAAGAATTTTACAGCGACTGCAGCTCAGAATGTATAAAAAGAAAGGAATTCAGGAATCTGAGCCTGAGGTTACCTCATTTTTCCCTGAGCCAGATGATGTTGAAAGTTTGCTGATTACCCCCTTCTTG

esiRNA cDNA target sequence

CATCATGACGCTGGTCTCTGGGATTCCAATGGGCCCACCCCGGCTTCCTCTGCAGAAAGCCACCCAGGAGTTTACTGCTAAGGCTGAGGCCAAGCTAAAGAGCCTGGATTTCCTTTCTTCCCCTAGTGTAAAGGAGGGGAAGCCTTTAGCTAGTGCCTGATAAGTCTGGGTGTGTAAGCTTAGACTTATCTATCTTCAATAGTACATTCTTTTCTCAGGGACTTTTTTAGGTGAATTTGAACCCATCTTTATTTTAGGAAGTAGAATCCCACACCAATCAAATATTGATTATGAACCTAAACTTTTTTGTTATAAAGGAGTCACAAGCTCTAAGTCATTCATTTTGTAAAATTATTATAGAGAAATCTCTACTTATACAGATGCAATGGAACCAAGTGAA

Ensembl | mouse accession no.

ENSMUSG00000064267

Ensembl | mouse accession no.

ENSMUSG00000028608

Ensembl | mouse accession no.

ENSMUSG00000052915

Ensembl | mouse accession no.

ENSMUSG00000042684

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

NCBI accession no.

NP_001035954

NCBI accession no.

NM_028754

NCBI accession no.

NM_028722

NCBI accession no.

NM_028749

General description

ColorWheel® technology is a novel and proprietary method of creating your own antibody and dye combinations for use in flow cytometry. By incubating any ColorWheel® antibody with any ColorWheel® dye, researchers can quickly and simply produce primary conjugated antibodies for use in single color or multicolor flow cytometry analysis. Each ColorWheel® antibody and dye is lyophilized for long long-term storage, allowing for simplicity and flexibility without compromise. ColorWheel® technology requires both ColorWheel® antibody and ColorWheel® dye for Flow Cytometry application.
We are committed to bringing you greener alternative products, which adhere to one or more of The 12 Principles of Green Chemistry.This product is Preservative-free, lyophilized product for enhanced stability and allow for ambient shipping and thus aligns with "Waste Prevention", "Designing Safer Chemicals" and "Design for Energy Efficiency". Click here for more information.

Specificity

Clone 16-10A1 is an Armenian Hamster monoclonal antibody that detects murine CD80.

Immunogen

Chinese Hamster ovary cells transfected with mouse B7 (CD80).

Application

Quality Control Testing:

Evaluated by Flow Cytometry in C57BL/6 mouse splenocytes.

Flow Cytometry Analysis: Staining of one million mouse splenocyte cells (with and without 3-day LPS stimulation) was performed using 5 μL of a 1:1 mixture of Cat. No. CWA-1022, Anti-Mouse CD80 (16-10A1) ColorWheel® Dye-Ready mAb and Cat. No. CWD-PE ColorWheel® Antibody-Ready Phycoerythrin (PE) Dye or an equivalent amount of PE-conjugated Armenian Hamster IgG isotype control.

Note: Actual optimal working dilutions must be determined by end user as specimens, and experimental conditions may vary with the end user

Compatibility

Requires ColorWheel® Dye (Sold Separately)

Target description

T-lymphocyte activation antigen CD80 (UniProt: Q00609; also known as Activation B7-1 antigen, B7, CD80) is encoded by the Cd80 (also known as B7) gene (Gene ID: 12519) in murine species. CD80 is a single-pass type I membrane glycoprotein that is synthesized with a signal peptide (aa 1-37), which is subsequently cleaved off to generate the mature form that contains an extracellular domain (aa 38-246), a transmembrane domain (aa 247-268), and a cytoplasmic domain (aa 269-306). It is one of the most potent costimulatory molecules involved in the recognition and killing of tumor cells. It is expressed transiently on dendritic cells, activated B cells, macrophage, gamma-interferon stimulated monocytes, and non-circulating B-cell malignancies. CD80 is involved in the co-stimulatory signal that is essential for T-cell activation. CD80 can bind to both CD28 and CTLA-4 (CD152). Its binding to CD28 leads to activation of T-cells, however, binding to CTLA-4 blocks T-cell activation. Thus, in the absence of CTLA-4, CD80 provides unopposed stimulatory signals through CD28 that permit weakly self-reactive T cells to become fully activated. In tandem with CD86 (B7-2), it plays a large and diverse role in the regulation of both the adaptive and the innate immune system. However, CD80 has a significantly higher affinity and avidity of both CD28 and CTLA-4 than CD86. CD80 levels are downregulated on most of the cancer cells, and the loss of CD80 alone is reported to be sufficient to allow them to escape the immune system. Higher expression of CD80 has been reported in colon epithelial cells of human preneoplastic lesions. Clone 16-10A1 is reported to block CD80 binding to CD28/CTLA-4 but not B7-H1. (Ref.: Park, J.J., et al. (2010). Blood. 116(8); 1291-1298; Butte, MJ. (2008). Mol. Immunol. 45(13); 3567-3572; Tirapu, I., et al.(2006). Cancer Res. 66(4); 2442-2450; Sansom, DM. (2000). Immunology. 101(2); 169-177).

Physical form

Lyophilized from PBS containing D-Mannitol and Sucrose, normal appearance is a dried pellet. Reconstituted antibody solution is stable and functional as assessed by functional testing. Contains no biocide or preservatives, such as azide.

Reconstitution

1.0 mg/mL after reconstitution at 25 μL in PBS. Please refer to guidance on suggested starting dilutions and/or titers per application and sample type.

Storage and Stability

Recommend storage of lyophilized product at 2-8°C. Before reconstitution, micro-centrifuge vials briefly to spin down material to bottom of the vial. Reconstitute each vial by adding 25 μL of PBS. Protect from light.

Legal Information

ColorWheel is a registered trademark of Merck KGaA, Darmstadt, Germany

Disclaimer

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Not finding the right product?  

Try our Product Selector Tool.

related product

Product No.
Description
Pricing

Storage Class Code

13 - Non Combustible Solids

WGK

WGK 2

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

常规特殊物品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service