Skip to Content

Dear Customer:

The current international situation is complex and volatile, and uncertain tariff policies may potentially impact our product prices. Given these uncertainties, we value your understanding regarding order-related matters.

If you decide to place an order during this period, we reserve the right to adjust the price based on the evolving situation. We understand that market changes may cause inconvenience. We will negotiate with you if there’s a significant price fluctuation due to tariff policy changes before the order’s actual delivery, and in such cases we may adjust or cancel the order as necessary.

Merck
CN
All Photos(1)

Key Documents

Safety Information

C-28009

Sigma-Aldrich

Mesenchymal Stem Cell Growth Medium 2

Ready-to-use kit including Basal Medium and SupplementMix, 500 ml

Synonym(s):

Primary Cell Culture Media

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
¥3,096.05
50 μG
¥5,521.21

¥3,096.05


Estimated to ship on2025年7月18日Details


Request a Bulk Order

Select a Size

Change View
20 μG
¥3,096.05
50 μG
¥5,521.21

About This Item

UNSPSC Code:
12352207
NACRES:
NA.81

¥3,096.05


Estimated to ship on2025年7月18日Details


Request a Bulk Order

form

liquid

packaging

pkg of 500 ml

technique(s)

cell culture | mammalian: suitable

shipped in

wet ice

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU072451EMU085071EMU069331
esiRNA cDNA target sequence

TCATTCTCTTACAACCACCTTCCATATACCTTCAAGTCAACATTACCAAGAAGAGCATTCACCATCATTGTCAGGATCAGATTCTCTTCTTCAAATAACCACTCCTGTGGTGGCTTCAACTGTAGGTAACCCAAATCAGCATTCAGCAACAATGTCAACACCAGCTATTCATGTCTCAACTTATCACACGGCCCCTACTGAAGTGTCTGCTGCGTTTGAAGAACAGCCTGTCTCACCACACATTGGAGGAATGCCGTCACCAATTCAACACGATTTTCCTGCACTAGTGATGATACTCATAATTTTGGGCGTGATGGCAGGGATTATCGGAACTATCCTTCTTATCTCTTACTGTATCAGCCGAATGACAAAGAAAAGTTCAGTTGACATCCAATCTCCTGAGGGTGGTGACAACAGTGTGCCTTTGAGTTCTATTGAGCAGACTCCTAATGAAGAGTCCTCCAATGTTTGAAAGACCTCAAGGAAAACAAGACTTCAATCAATGGGAAA

esiRNA cDNA target sequence

GGGCAGGTTGAGTTCATTGTAAATAATTGTGTAAATCACTGTTCTAGTAATTTAAAAATAACATTAATTTTTCTACAAAATGCGAGATTTATAAATGTTTGAAATTGTACCTATTGATAATTAATGGTAAGTTTACTTAAAATAAATGTATCCCTTATTTCTTATCTGCATTTCTCATTTCCAGATGAAAGTTTAGTTATCAGAGATGTTTCAGCACACACAAAAGCCACTTTTCAGTACTTGTTCACATGCACTGACGAGCTAATTAGCAGCAGAAGTGGTTTCTGGAATGATGAACACCTTAATCATTCTGTTAGAACAGATTAGACAGTTCCTACCTCAGCATTTTCAGAAAACACACTTTCAAGGCCAAAAGCCATCATCATCAGTAGAGTCTCCCCTTGCTGAGACCTAATTATCTCCGGGGTTCCATC

esiRNA cDNA target sequence

TGACAGCGAAGGCAATGTAGTGAACAAACCCGACAGCCATGGTGGCAGCCTCGAATGGACAAAGATCTGTGAGAAGTCCTCTAAAGTGATCACCTTCATCGACTTGGCTGGCCACGAGAAGTACCTTAAGACCACTGTTTTTGGCATGACTGGCCACTTGCCTGACTTCTGCATGCTCATGGTGGGCAGCAATGCTGGCATTGTGGGGATGACCAAGGAGCATCTGGGCTTGGCATTGGCACTCAATGTACCTGTGTTTGTGGTTGTCACCAAGATTGACATGTGTCCTGCCAACATCCTTCAAGAAACCCTGAAGCTGCTACAGCGCCTGCTGAAGTCACCAGGCTGCCGGAAGATCCCTGTCCTGGTGCAGAGCAAAGATGATGTGATTGTCACAGCCTCCAACTTCAGCTCTGAGAGGATGTGCCCGATATTCCAGATCTCCAATGTCACAGGTGAGAACCTTGACCTGCTCAAGATGTTCCTCAACCTCCTGTCC

esiRNA cDNA target sequence

CACCAGTTTCGGACCAGTTTCAGACCACGATATGGAGTATACAATAGATGTGTTTTTCCGTCAAAGTTGGAAGGATGAAAGATTAAAATTCAAAGGACCCATGACAGTGCTCCGGCTAAACAACCTTATGGCCAGTAAAATCTGGACTCCAGATACATTTTTCCACAATGGAAAGAAGTCTGTGGCCCACAACATGACCATGCCTAATAAGCTCCTGCGTATCACAGAGGATGGCACTCTGCTGTACACCATGAGGTTGACCGTGAGAGCTGAATGCCCAATGCACTTGGAAGACTTCCCTATGGATGCCCATGCCTGCCCACTAAAATTCGGAAGCTATGCTTATACAAGAGCAGAAGTTGTCTATGAGTGGACCAGAGAGCCAGCCCGTTCAGTGGTTGTAGCAGAAGATGGGTCACGTTT

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Ensembl | mouse accession no.

ENSMUSG00000051839

Ensembl | mouse accession no.

ENSMUSG00000025059

Ensembl | mouse accession no.

ENSMUSG00000042535

Ensembl | mouse accession no.

ENSMUSG00000010803

Gene Information

mouse ... GYPA(14934), Gypa(14934)

Gene Information

mouse ... GYK(14933), Gyk(14933)

Gene Information

mouse ... GTPBP1(14904), Gtpbp1(14904)

Gene Information

mouse ... GABRA1(14394), Gabra1(14394)

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

Mesenchymal Stem Cell Growth Medium (Ready-to-use)

Application

Mesenchymal Stem Cell Growth Medium 2 is an optimized low-serum formulation for routine culture of multipotent human Mesenchymal Stem Cells. Rigorous quality control tests ensure reliable and consistent product quality.Recommended for:Human Mesenchymal Stem Cells from Bone Marrow (hMSC-BM)Human Mesenchymal Stem Cells from Umbilical Cord Matrix (hMSC-UC)Human Mesenchymal Stem Cells from Adipose Tissue (hMSC-AT)

Quality

All lots of PromoCell Mesenchymal Stem Cell Media are subjected to comprehensive quality control tests using primary human mesenchymal stem cells. Each lot of MSC Growth Medium is checked for maintenance of multipotency, growth promoting activity, adherence rate, and typical morphology of the tested mesenchymal stem cells. In addition, all lots of media have been tested for the absence of microbial contaminants (fungi, bacteria, mycoplasma).

Storage and Stability

Store the Basal Medium at 4 to 8°C in the dark and the SupplementMix at -20°C immediately after arrival. Do not freeze the Basal Medium. If stored properly, the products are stable until the expiry date stated on the label. After adding the supplements to the Basal Medium, the shelf life of the complete medium is 6 weeks at 4 to 8°C. Do not freeze the complete medium. For use, pre-warm only an aliquot of the complete medium and keep the remaining medium refrigerated at 4 to 8°C.

Subculture Routine

Click here for more information.

Storage Class Code

10 - Combustible liquids

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Articles

Are your mesenchymal stem cells really MSCs? Learn more about the MSC characterization guidelines proposed by the International Society for Cellular Therapy (ISCT).

Protocol to differentiate human mesenchymal stem cells into neurons with extensive dendrites and axons in 3 days. Explore over 350 PromoCell products on Sigma.com.

Highly characterized human mesenchymal stem cell lines from bone-marrow, adipose and umbilical cord along with serum-free MSC expansion and differentiation media.

Frequently asked questions about mesenchymal stem cells including MSC derivation, expansion, differentiation and allogenic stem cell therapy.

Protocols

Osteogenesis, adipogenesis and chondrogenesis differentiation protocols and media for human mesenchymal stem cell culture. Explore over 350 PromoCell products on our company website.

Mesenchymal Stem Cells and Media enable in vitro expansion and differentiation, vital for various tissue sources.

Information about mesenchyme, specifically mesenchymal stem cell procotols. Step-by-step cell culture protocols for mesenchymal stem cell (MSC) isolation, expansion and differentiation.

Related Content

Explore expert protocols and culture media for human primary cell lines to replicate biological systems accurately.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service