ZIQUVLPA1
ech2o® UV lamp
for use with Milli-Q® IQ Systems, Mercury-free UV lamp for photooxidation of organic compounds
Select a Size
Select a Size
About This Item
Recommended Products
Quality Level
packaging
pkg of 1 unit
manufacturer/tradename
ech2o®
compatibility
for use with Milli-Q® IQ 7000
for use with Milli-Q® IQ 7003
for use with Milli-Q® IQ 7005
for use with Milli-Q® IQ 7010
for use with Milli-Q® IQ 7015
Looking for similar products? Visit Product Comparison Guide
Related Categories
1 of 4
This Item | EHU067331 | EHU087831 | EHU088431 |
---|---|---|---|
esiRNA cDNA target sequence CAGCGCATATCATCTCATGGGGTCCAGAGTGGAGTCCAGGCTTCTCTGAAACCAGGGCTGAGCATATTTCCATAGCCAAGGAGGTGGGACTCCCTGGAGCTATCTGTGGTCTTAGGGAAGGATCCAGACATACACGGCTTTGGGGTACAAGCTGTGATCACTGATCAATAAATTATCTCTAGATTGGTCCTTGTGAGGGGAGTTTTAAGAATCCAGAACATCTTGCTCTTGATCAGCACATCCAAAAACACCAAGACAAACATCCAGTGGAGCAGAACCTCTCCTGCCTCGGGAGTTCTGACCGGGTTCCCCAGCAGGGTGTTAAGCCTCTGTCTCTGGCCCTACCAGCATCCAGGTTCCACTTTCCTAGGAGAGAGTGGAGATGGGAAGACAGGGAAAGGAAGG | esiRNA cDNA target sequence CACAAGGACCACCAGTACCAGTTCTTAGAGGATGCAGTGAGGAACCAGCGCAAGCTCCTGGCCTCACTGGTGAAGCGCCTTGGGGACAAACATGCAACATTGCAGAAGAGCACCAAGGAGGTTCGCAGCTCAATCCGCCAGGTGTCTGACGTACAGAAGCGTGTGCAAGTGGATGTCAAGATGGCCATCCTGCAGATCATGAAGGAGCTGAATAAGCGGGGCCGTGTGCTGGTCAATGATGCCCAGAAGGTGACTGAGGGGCAGCAGGAGCGCCTGGAGCGGCAGCACTGGACCATGACCAAGATCCAGAAGCACCAGGAGCACATTCTGCGCTTTGCCTCTTGGGCTCTGGAGAGTGACAACAACACAGCCCTTTTGCTTTCTAAGAAGTTGATCTACTTCCAGCTGCACCG | esiRNA cDNA target sequence TCATGGATGCTCTGGATGAGAGAGCCAAGGTGCTGCATGAGGACAAGCAGACCCGGGAGCAGCTGCATAGCATCAGCGACTCTGTGTTGTTTCTGCAGGAATTTGGTGCATTGATGAGCAATTACTCTCTCCCCCCACCCCTGCCCACCTATCATGTCCTGCTGGAGGGGGAGGGCCTGGGACAGTCACTAGGCAACTTCAAGGACGACCTGCTCAATGTATGCATGCGCCACGTTGAGAAGATGTGCAAGGCGGACCTGAGCCGTAACTTCATTGAGAGGAACCACATGGAGAACGGTGGTGACCATCGCTATGTGAACAACTACACGAACAGCTTCGGGGGTGAGTGGAGTGCACCGGACACCATGAAGAGATACTCCATGTACCTGACACCCAAAGGTGGGGTCCGGACATCATACCAGCCCTCGTC | esiRNA cDNA target sequence ATGAACAATATAAAGCACTTAAAGGAAGAGGATGATTTCTTCCAGCTTTTCCACACTCTCTTTATGCGCAGGAACAAACAGCTGTTGAGTGAGCTGCTATGACTTTGGTAGAGAGGTGCAATATGTTTTTTGAACCAGCTATAAAAGAAATTAAGAGGTACATGTGAGGGTAGAAACAAATATCAAGGATGAGAATGGCACTGGCTGTCCCATATGGTATCCAGGAGCCACCAATGTCTGTTGAGTACTTCATACATGCCTAGTCTGAATTGAGATGTGCTCAATGTATAAAATATATACCAGATTTCAAATACCTACTTCAAAAAATAATGTAAAATATCTCACTAATAACTTTTCCTTTGTGTATTGCAATGATAATATGTTGGCTCTATTGGATTAA |
product line MISSION® | product line MISSION® | product line MISSION® | product line MISSION® |
Ensembl | human accession no. | Ensembl | human accession no. | Ensembl | human accession no. | Ensembl | human accession no. |
NCBI accession no. | NCBI accession no. | NCBI accession no. | NCBI accession no. |
storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
General description
For use with Milli-Q® IQ 7000 and Milli-Q® IQ 7003/05/10/15 systems.
Application
Features and Benefits
Legal Information
Certificates of Analysis (COA)
Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
How frequently do the various consumables need to be changed?
The frequency that consumables must be changed depends on the system's usage (treated water volume) and on the consumables themselves (time of usage). In order to ensure the quality of water and your results, the consumables should be replaced when the system alerts you.
What is the shelf life for UV Lamp?
The shelf life is 2 years for all consumables kept in the recommended storage conditions (temperatures from 5 to 30°C; humidity between 10 and 80%). Contact your local representative for more information.
Can I arrange to have my consumables automatically ordered and delivered once a year?
It's possible to place only one consumable order per year with a specific contract called "Consumable Supply Agreement (CSA)" For further information, contact your local representative or sales contact.
Can I change the UV lamp myself?
No. With the exception of our SMART system range, a field service engineer must change the UV lamp as this process can be dangerous for customers and requires special protective equipment.
Where can I find data sheets, Certificates of Origin, Certificates of Analysis, and Certificates of Quality?
Documents and certificates are available in the "Documentation" section on this page. Do not hesitate to contact us if you require further information.
What steps are you taking towards improved sustainability?
Sustainability is at the heart of our innovations. From reducing water and energy consumption, to minimizing plastic and chemical waste, our dedicated water system engineers are constantly working on new ways to reduce the ecological footprint of our products to better support the sustainability goals we’re all striving towards. For more information, we invite you to review the following brochure and infographic which highlight our efforts and achievements: link. Do not hesitate to contact your local representative for further information.
How can I know which consumables can be used with my system?
To know which consumables can be used on your system, you can see in the user manual of you system or see it on the following webpage of consumables. All the consumables for each system are indicated.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service