Skip to Content

The system is currently under maintenance, and the website's ordering function is temporarily unavailable. We sincerely regret any inconvenience this may cause. If you need any further assistance, please contact our Customer Contact Center at 400 620 3333.

Merck
CN

ZIQUVLPA1

Milli-Q

ech2o® UV lamp

for use with Milli-Q® IQ Systems, Mercury-free UV lamp for photooxidation of organic compounds

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
CN¥3,096.05
50 μG
CN¥5,521.21

CN¥3,096.05


Estimated to ship onJune 27, 2025Details



Select a Size

Change View
20 μG
CN¥3,096.05
50 μG
CN¥5,521.21

About This Item

UNSPSC Code:
41104200
NACRES:
NB.33

CN¥3,096.05


Estimated to ship onJune 27, 2025Details


Quality Level

packaging

pkg of 1 unit

manufacturer/tradename

ech2o®

compatibility

for use with Milli-Q® IQ 7000
for use with Milli-Q® IQ 7003
for use with Milli-Q® IQ 7005
for use with Milli-Q® IQ 7010
for use with Milli-Q® IQ 7015

Looking for similar products? Visit Product Comparison Guide

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU067331EHU087831EHU088431
esiRNA cDNA target sequence

CAGCGCATATCATCTCATGGGGTCCAGAGTGGAGTCCAGGCTTCTCTGAAACCAGGGCTGAGCATATTTCCATAGCCAAGGAGGTGGGACTCCCTGGAGCTATCTGTGGTCTTAGGGAAGGATCCAGACATACACGGCTTTGGGGTACAAGCTGTGATCACTGATCAATAAATTATCTCTAGATTGGTCCTTGTGAGGGGAGTTTTAAGAATCCAGAACATCTTGCTCTTGATCAGCACATCCAAAAACACCAAGACAAACATCCAGTGGAGCAGAACCTCTCCTGCCTCGGGAGTTCTGACCGGGTTCCCCAGCAGGGTGTTAAGCCTCTGTCTCTGGCCCTACCAGCATCCAGGTTCCACTTTCCTAGGAGAGAGTGGAGATGGGAAGACAGGGAAAGGAAGG

esiRNA cDNA target sequence

CACAAGGACCACCAGTACCAGTTCTTAGAGGATGCAGTGAGGAACCAGCGCAAGCTCCTGGCCTCACTGGTGAAGCGCCTTGGGGACAAACATGCAACATTGCAGAAGAGCACCAAGGAGGTTCGCAGCTCAATCCGCCAGGTGTCTGACGTACAGAAGCGTGTGCAAGTGGATGTCAAGATGGCCATCCTGCAGATCATGAAGGAGCTGAATAAGCGGGGCCGTGTGCTGGTCAATGATGCCCAGAAGGTGACTGAGGGGCAGCAGGAGCGCCTGGAGCGGCAGCACTGGACCATGACCAAGATCCAGAAGCACCAGGAGCACATTCTGCGCTTTGCCTCTTGGGCTCTGGAGAGTGACAACAACACAGCCCTTTTGCTTTCTAAGAAGTTGATCTACTTCCAGCTGCACCG

esiRNA cDNA target sequence

TCATGGATGCTCTGGATGAGAGAGCCAAGGTGCTGCATGAGGACAAGCAGACCCGGGAGCAGCTGCATAGCATCAGCGACTCTGTGTTGTTTCTGCAGGAATTTGGTGCATTGATGAGCAATTACTCTCTCCCCCCACCCCTGCCCACCTATCATGTCCTGCTGGAGGGGGAGGGCCTGGGACAGTCACTAGGCAACTTCAAGGACGACCTGCTCAATGTATGCATGCGCCACGTTGAGAAGATGTGCAAGGCGGACCTGAGCCGTAACTTCATTGAGAGGAACCACATGGAGAACGGTGGTGACCATCGCTATGTGAACAACTACACGAACAGCTTCGGGGGTGAGTGGAGTGCACCGGACACCATGAAGAGATACTCCATGTACCTGACACCCAAAGGTGGGGTCCGGACATCATACCAGCCCTCGTC

esiRNA cDNA target sequence

ATGAACAATATAAAGCACTTAAAGGAAGAGGATGATTTCTTCCAGCTTTTCCACACTCTCTTTATGCGCAGGAACAAACAGCTGTTGAGTGAGCTGCTATGACTTTGGTAGAGAGGTGCAATATGTTTTTTGAACCAGCTATAAAAGAAATTAAGAGGTACATGTGAGGGTAGAAACAAATATCAAGGATGAGAATGGCACTGGCTGTCCCATATGGTATCCAGGAGCCACCAATGTCTGTTGAGTACTTCATACATGCCTAGTCTGAATTGAGATGTGCTCAATGTATAAAATATATACCAGATTTCAAATACCTACTTCAAAAAATAATGTAAAATATCTCACTAATAACTTTTCCTTTGTGTATTGCAATGATAATATGTTGGCTCTATTGGATTAA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Ensembl | human accession no.

ENSG00000137313

Ensembl | human accession no.

ENSG00000130726

Ensembl | human accession no.

ENSG00000137699

Ensembl | human accession no.

ENSG00000121236

NCBI accession no.

NM_003449

NCBI accession no.

NM_005762

NCBI accession no.

NM_012101

NCBI accession no.

NM_001003819

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

The mercury-free ECH2O® UV Lamp is used to photooxidize organic compounds.
For use with Milli-Q® IQ 7000 and Milli-Q® IQ 7003/05/10/15 systems.

Application

Water treated by this UV lamp is low in organic contaminants and suitable for all organic-sensitive applications (e.g. HPLC, etc.)

Features and Benefits

This unique ECH2O® mercury-free UV lamp ensures oxidation of organic contaminants using xenon excimer (excited dimer) technology, emitting at 172 nm wavelength.

Legal Information

ECH2O is a registered trademark of Merck KGaA, Darmstadt, Germany
Milli-Q is a registered trademark of Merck KGaA, Darmstadt, Germany

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

  1. How frequently do the various consumables need to be changed?

    The frequency that consumables must be changed depends on the system's usage (treated water volume) and on the consumables themselves (time of usage). In order to ensure the quality of water and your results, the consumables should be replaced when the system alerts you.

  2. What is the shelf life for UV Lamp?

    The shelf life is 2 years for all consumables kept in the recommended storage conditions (temperatures from 5 to 30°C; humidity between 10 and 80%). Contact your local representative for more information.

  3. Can I arrange to have my consumables automatically ordered and delivered once a year?

    It's possible to place only one consumable order per year with a specific contract called "Consumable Supply Agreement (CSA)" For further information, contact your local representative or sales contact.

  4. Can I change the UV lamp myself?

    No. With the exception of our SMART system range, a field service engineer must change the UV lamp as this process can be dangerous for customers and requires special protective equipment.

  5. Where can I find data sheets, Certificates of Origin, Certificates of Analysis, and Certificates of Quality?

    Documents and certificates are available in the "Documentation" section on this page. Do not hesitate to contact us if you require further information.

  6. What steps are you taking towards improved sustainability?

    Sustainability is at the heart of our innovations. From reducing water and energy consumption, to minimizing plastic and chemical waste, our dedicated water system engineers are constantly working on new ways to reduce the ecological footprint of our products to better support the sustainability goals we’re all striving towards. For more information, we invite you to review the following brochure and infographic which highlight our efforts and achievements: link. Do not hesitate to contact your local representative for further information.

  7. How can I know which consumables can be used with my system?

    To know which consumables can be used on your system, you can see in the user manual of you system or see it on the following webpage of consumables. All the consumables for each system are indicated.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service