Skip to Content
Merck
CN
All Photos(1)

Key Documents

MABS1327

Sigma-Aldrich

Anti-Podocalyxin (GP135) Antibody, clone 3F2:D8

clone 3F2:D8, from mouse

Synonym(s):

Podocalyxin-like protein 1, GP1345, PC, PC-like protein 1, PCLP-1, cPCLP1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
¥3,096.05
50 μG
¥5,521.27

¥3,096.05


Estimated to ship on2025年5月26日Details


Request a Bulk Order

Select a Size

Change View
20 μG
¥3,096.05
50 μG
¥5,521.27

About This Item

UNSPSC Code:
12352203
eCl@ss:
32160702
NACRES:
NA.41

¥3,096.05


Estimated to ship on2025年5月26日Details


Request a Bulk Order

biological source

mouse

Quality Level

antibody form

purified immunoglobulin

antibody product type

primary antibodies

clone

3F2:D8, monoclonal

species reactivity

canine

packaging

antibody small pack of 25 μL

technique(s)

immunocytochemistry: suitable
immunofluorescence: suitable
immunoprecipitation (IP): suitable
radioimmunoassay: suitable
western blot: suitable

isotype

IgG1κ

NCBI accession no.

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU111931EHU019461EHU131531
product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

esiRNA cDNA target sequence

AGCCCACAGAAGAAGAAGCATCTTCAAAGGAGGATTCTGCACCTTCTAAGCCAGTTGTGGGGATTATTTACCCTCCTCCAGAGGTCAGAAATATTGTTGACAAGACTGCCAGCTTTGTGGCCAGAAACGGGCCTGAATTTGAAGCTAGGATCCGACAGAACGAGATCAACAACCCCAAGTTCAACTTTCTGAACCCCAATGACCCTTACCATGCCTACTACCGCCACAAGGTCAGCGAGTTCAAGGAAGGGAAGGCTCAGGAGCCGTCCGCCGCCATCCCCAAGGTCATGCAGCAGCAGCAGCAGACCACCCAGCAGCAGCTGCCCCAGAAGGTCCAAGCCCAAGTAATCCAAGAGACCATCGTGCCCAAAGAGCCTCCTCCTGAGTTTGAGTTCATTGCTGATCCTCCCTCTATCTCAGCCTTCGACTTGGA

esiRNA cDNA target sequence

AGGACCCAATGAGTTTGCTGAATTCTATAATAGACTCAAGCAAATAAAGGAATTCCACCGGAAGCACCCAAATGAGATCTGTGTGCCAATGTCAGTGGAATTTGAGGAACTCCTGAAGGCTCGAGAGAATCCAAGTGAAGAGGCACAAAACTTGGTGGAGTTCACAGATGAAGAGGGATATGGTCGTTATCTCGATCTCCATGACTGTTACCTCAAGTACATTAACCTGAAGGCATCTGAGAAGCTGGATTATATCACATACCTGTCCATCTTTGACCAATTATTTGACATTCCTAAAGAAAGGAAGAATGCAGAGTATAAGAGATACCTAGAGATGCTGCTTGAGTACCTTCAGGATTACACAGATAGAGTGAAGCCTCTCCAAGATCAGAATGAACTTTTTGGGAAGATTCAGGCTGAGTTTGAGAAGAAATGGGAGAATGGGACC

esiRNA cDNA target sequence

TCCGAAGAGAGGTGGAGAAACCTAAAGACTGAGGAGAAGAGATCCTTTGAGCCAGATGGGGCATTAGTTCTTCTGCTTTTCTCAGCATGGATAAACCATTTCCTCAAGGATTTTCTCATGTGCCCTGAAATCCATGTAACTACAAGGGCTCCTCTTTATCACCATAAGTGCCACCCTGACTTAAAACCACTCAGAGCTAAAAAATCAAGGCAAAATGGATGCTGCGGTGACAGATGATTTTCAACAAATTCTGCCTATTGAACAGCTGCGCTCTACTCATGCTAGCAATGACTACGTGGAACGGCCTCCAGCCCCCTGTAAACAGGCCCTCTCCAGCCCTTCCCTTATTGTGCAAACCCACAAGTCTGATTGGTCTCTGGCTACCATGCCTACTTCTCTCCCCCGCAGTCTCAGCCAGTGCCATCAACTGCAGCCCTTGCCTCAGCATCTGAGCCAATCTAGCATTGCCAGCTCAATGTCCCATAGCACCACTGCCTCTGA

esiRNA cDNA target sequence

TGTGGAGTTGGCAAACAAAGTAGGTGCAGCAGAAATTATATCCAGGATTGTGGATGATCTGAAAGATGAAGCCGAACAGTACAGAAAAATGGTGATGGAGACAATTGAGAAAATTATGGGTAATTTGGGAGCAGCAGATATTGATCATAAACTTGAAGAACAACTGATTGATGGTATTCTTTATGCTTTCCAAGAACAGACTACAGAGGACTCAGTAATGTTGAACGGCTTTGGCACAGTGGTTAATGCTCTTGGCAAACGAGTCAAACCATACTTGCCTCAGATCTGTGGTACAGTTTTGTGGCGTTTAAATAACAAATCTGCTAAAGTTAGGCAACAGGCAGCTGACTTGATTTCTCGAACTGCTGTTGTCATGAAGACTTGTCAAGAGGAAAAATTGATGGGACACTTGGGTGTTGTATTGTATGAGTATTTGGGTGAAGAGTACCCTGAAGTATTGGGCAGCAT

Ensembl | human accession no.

ENSG00000099995

Ensembl | human accession no.

ENSG00000183431

Ensembl | human accession no.

ENSG00000168939

Ensembl | human accession no.

ENSG00000115524

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

General description

Podocalyxin (UniProt: Q52S86; also known as Gp135, Podocalyxin-like protein 1, PC, PC-like protein 1, PCLP-1, cPCLP1) is encoded by the PODXL (also known as PCLP, PCLP1) gene (Gene ID: 482252) in canine species. GP135 is an apical membrane protein expressed in polarized MDCK epithelial cells. Some expression is also observed in heart, lung, renal cortex and medulla, and muscle. It has an extracellular domain (aa 23-474), a helical domain (aa 475-495) and a cytoplasmic domain (aa 496-571). Its cytoplasmic domain is shown to be essential for the apical membrane targeting and renal tubulogenesis. GP135 is involved in the regulation of both adhesion and cell morphology and cancer progression. It functions as an anti-adhesive molecule that maintains an open filtration pathway between neighboring foot processes in the podocyte by charge repulsion. It can also act as a pro-adhesive molecule, enhancing the adherence of cells to immobilized ligands and thereby increasing the rate of migration and cell-cell contacts in an integrin-dependent manner. Gp135 is also reported to be involved in the formation of a preapical plasma membrane subdomain to set up initial epithelial polarization and the apical lumen formation during renal tubulogenesis. It co-localizes with actin filaments, ezrin and SLC9A3R1 in a punctate pattern at the apical cell surface where microvilli form. Gp135 is shown to undergo N- and O-linked glycosylation.

Specificity

Clone 3F2:D8 detects Podocalyxin in Madin-Darby canine kidney (MDCK) cells.

Immunogen

Epitope: extracellular domain
Intact Madin-Darby canine kidney (MDCK) cells.

Application

Anti-Podocalyxin (GP135), clone 3F2:D8, Cat. No. MABS1327, is a mouse monoclonal antibody that detects Podocalyxin (GP135) and has been tested for use in Immunocytochemistry, Immunofluorescence, Immunoprecipitation, Radioimmunoassay, and Western Blotting.
Research Category
Signaling
Western Blotting Analysis: A 1:500 dilution from a representative lot detected Podocalyxin (GP135) in MDCK treated with iodoacetamid cell lysate.

Radioimmunoassay Analysis: A representative lot detected Podocalyxin (GP135) in Radioimmunoassay applications (Ojakian, G.K., et. al. (1988). J Cell Biol. 107(6 Pt 1):2377-87).

Immunofluorescence Analysis: A representative lot detected Podocalyxin (GP135) in Immunofluorescence applications (Ojakian, G.K., et. al. (1988). J Cell Biol. 107(6 Pt 1):2377-87; Cheng, H.Y., et. al. (2005). J Am Soc Nephrol. 16(6):1612-22).

Immunocytochemistry Analysis: A 1:100 dilution from a representative lot detected Podocalyxin (GP135) in MDCK cells (Courtesy of Dr. Tzuu-Shuh Jou, M.D., Ph.D., Graduate Institute of Clinical Medicine, College of Medicine, National Taiwan University).

Immunocytochemistry Analysis: A representative lot detected Podocalyxin (GP135) in Immunocytochemistry applications (Ojakian, G.K., et. al. (1988). J Cell Biol. 107(6 Pt 1):2377-87; Cheng, H.Y., et. al. (2005). J Am Soc Nephrol. 16(6):1612-22).

Western Blotting Analysis: A representative lot detected Podocalyxin (GP135) in Western Blotting applications (Ojakian, G.K., et. al. (1988). J Cell Biol. 107(6 Pt 1):2377-87; Cheng, H.Y., et. al. (2005). J Am Soc Nephrol. 16(6):1612-22).

Immunoprecipitation Analysis: A representative lot detected Podocalyxin (GP135) in Immunoprecipitation applications (Ojakian, G.K., et. al. (1988). J Cell Biol. 107(6 Pt 1):2377-87; Cheng, H.Y., et. al. (2005). J Am Soc Nephrol. 16(6):1612-22).

Quality

Evaluated by Western Blotting in MDCK cell lysate.

Western Blotting Analysis: A 1:1,000 dilution of this antibody detected Podocalyxin (GP135) in MDCK cell lysate.

Target description

180 kda obseerved; 59.91 kDa calculated. Uncharacterized bands may be observed in some lysate(s).

Physical form

Format: Purified
Protein G purified
Purified mouse monoclonal antibody IgG1 in buffer containing 0.1 M Tris-Glycine (pH 7.4), 150 mM NaCl with 0.05% sodium azide.

Storage and Stability

Stable for 1 year at 2-8°C from date of receipt.

Other Notes

Concentration: Please refer to lot specific datasheet.

Disclaimer

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Select a Product Number

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Gawoon Shim et al.
Nature communications, 15(1), 2938-2938 (2024-04-06)
Epithelial tissues sheath organs and electro-mechanically regulate ion and water transport to regulate development, homeostasis, and hydrostatic organ pressure. Here, we demonstrate how external electrical stimulation allows us to control these processes in living tissues. Specifically, we electrically stimulate hollow
Christin Hanke-Gogokhia et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 35(7), e21689-e21689 (2021-06-05)
Knockout of the chloride channel protein 2 (CLC-2; CLCN2) results in fast progressing blindness in mice. Retinal Pigment Epithelium (RPE) and photoreceptors undergo, in parallel, rapid, and profound morphological changes and degeneration. Immunohistochemistry and electron microscopy of the outer retina
Qiao Zhang et al.
Current biology : CB, 29(17), 2826-2839 (2019-08-14)
The nucleoskeleton and cytoskeleton are important protein networks that govern cellular behavior and are connected together by the linker of nucleoskeleton and cytoskeleton (LINC) complex. Mutations in LINC complex components may be relevant to cancer, but how cell-level changes might
Arun A Chandrakumar et al.
The Journal of cell biology, 220(7) (2021-06-16)
Rab11 GTPase proteins are required for cytokinesis, ciliogenesis, and lumenogenesis. Rab11a is critical for apical delivery of podocalyxin (PODXL) during lumen formation in epithelial cells. SH3BP5 and SH3BP5L are guanine nucleotide exchange factors (GEFs) for Rab11. We show that SH3BP5
Ye Gu et al.
iScience, 27(5), 109272-109272 (2024-05-06)
For a long time, myeloid-derived suppressor cells (MDSCs) dilated in circulation system of colorectal cancer (CRC) patients have been puzzling clinicians. Various evidence shows that MDSCs constitute the bulk of immunosuppression in CRC, which is related to tumor growth, adhesion

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service