Skip to Content
Merck
CN

EHU051011

MISSION® esiRNA

targeting human PLK1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... PLK1(5347)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinhua Dong et al.
Biotechnology and bioengineering, 117(5), 1259-1269 (2020-02-11)
Ultra Quenchbody (UQ-body) is a biosensor that utilizes the quenching behavior of the fluorescent dye linked to the antibody V region. When the corresponding antigen is bound to the UQ-body, the fluorescence is restored and allows the detection of target
Dongzhi Wang et al.
Anti-cancer agents in medicinal chemistry, 17(7), 948-954 (2016-09-28)
Recent investigations have implicated that Chitosan-nucleotide nanoparticles might be useful non-viral carriers in gene therapy. Polo-like kinase 1 (PLK1) has been reported to be an important oncogene that exerted considerable therapeutic merit in hepatocellular carcinoma (HCC). We explored whether Galactosylated
Xiao Peng Cai et al.
American journal of translational research, 8(10), 4172-4183 (2016-11-11)
Cancer cell epithelial-mesenchymal transition (EMT) is the crucial event for cancer progression and plays a vital role in the metastasis of cancer cells. Activation of Polo-like kinase 1 (PLK1) signaling has been implicated as the critical event in several tumor
Jenille Tan et al.
PloS one, 11(12), e0168968-e0168968 (2016-12-29)
To date, lentiviral-based CRISPR-Cas9 screens have largely been conducted in pooled format. However, numerous assays are not amenable to pooled approaches, and lentiviral screening in arrayed format presents many challenges. We sought to examine synthetic CRISPR reagents in the context
Owen Addis Jones et al.
Nature communications, 10(1), 2861-2861 (2019-06-30)
Centromeres provide a pivotal function for faithful chromosome segregation. They serve as a foundation for the assembly of the kinetochore complex and spindle connection, which is essential for chromosome biorientation. Cells lacking Polo-like kinase 1 (PLK1) activity suffer severe chromosome alignment

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service