Select a Size
50 μG
CN¥5,521.21
CN¥5,521.21
Please contact Customer Service for Availability
All Photos(1)
Select a Size
Change View
50 μG
CN¥5,521.21
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
CN¥5,521.21
Please contact Customer Service for Availability
Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
shipped in
ambient
storage temp.
−20°C
1 of 4
This Item | EHUFLUC | EHURLUC | EHU090431 |
|---|---|---|---|
| product line MISSION® | product line MISSION® | product line MISSION® | product line MISSION® |
| storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
| form lyophilized powder | form lyophilized powder | form lyophilized powder | form lyophilized powder |
| description Powered by Eupheria Biotech | description Powered by Eupheria Biotech | description Powered by Eupheria Biotech | description Powered by Eupheria Biotech |
| shipped in ambient | shipped in ambient | shipped in ambient | shipped in ambient |
| Quality Level 100 | Quality Level 100 | Quality Level 100 | Quality Level 100 |
General description
EHUEGFP targets enhanced Green Fluorescent Protein (i.e. eGFP). It can be used as a negative control in systems lacking eGFP, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Other Notes
esiRNA cDNA target sequence: GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTA
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
常规特殊物品
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Lin Zhou et al.
Zygote (Cambridge, England), 24(1), 89-97 (2015-02-13)
ING2 (inhibitor of growth protein-2) is a member of the ING-gene family and participates in diverse cellular processes involving tumor suppression, DNA repair, cell cycle regulation, and cellular senescence. As a subunit of the Sin3 histone deacetylase complex co-repressor complex
Natalia I Díaz-Valdivia et al.
Oncogene, 39(18), 3693-3709 (2020-03-11)
Caveolin-1 (CAV1) enhanced migration, invasion, and metastasis of cancer cells is inhibited by co-expression of the glycoprotein E-cadherin. Although the two proteins form a multiprotein complex that includes β-catenin, it remained unclear how this would contribute to blocking the metastasis
Shalaka Chitale et al.
Nucleic acids research, 45(10), 5901-5912 (2017-04-13)
Repair of damaged DNA relies on the recruitment of DNA repair factors in a well orchestrated manner. As a prerequisite, the chromatin needs to be decondensed by chromatin remodelers to allow for binding of repair factors and for DNA repair
Johannes A M Merilahti et al.
Molecular biology of the cell, 28(22), 3123-3131 (2017-09-15)
Receptor tyrosine kinases (RTKs) have been demonstrated to signal via regulated intramembrane proteolysis, in which ectodomain shedding and subsequent intramembrane cleavage by gamma-secretase leads to release of a soluble intracellular receptor fragment with functional activity. For most RTKs, however, it
Vanessa Zurli et al.
Science signaling, 13(631) (2020-05-14)
Understanding the costimulatory signaling that enhances the activity of cytotoxic T cells (CTLs) could identify potential targets for immunotherapy. Here, we report that CD2 costimulation plays a critical role in target cell killing by freshly isolated human CD8+ T cells
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
