Predesigned shRNA

Dear Customer:

The current international situation is complex and volatile, and uncertain tariff policies may potentially impact our product prices. Given these uncertainties, we value your understanding regarding order-related matters.

If you decide to place an order during this period, we reserve the right to adjust the price based on the evolving situation. We understand that market changes may cause inconvenience. We will negotiate with you if there’s a significant price fluctuation due to tariff policy changes before the order’s actual delivery, and in such cases we may adjust or cancel the order as necessary.

We are planning system maintenance between Friday, Apr 11 at 9:00 PM CDT and Saturday, Apr 12 at 9:00 AM CDT. This will impact both web and offline transactions, including online orders, quotes, price and availability checks, and order status inquiries. We apologize for any inconvenience.

SupportWeb Training Customer Support Safety Data Sheets (SDS)Certificates (COA/COO)Quality & Regulatory Calculators & Apps Webinars

OrdersQuick Order Custom Products After-Sales Service eCommerce Solutions B2B Open Platform

CompanyAbout Us Responsibility Events Press Releases Programs Careers Offices

Social Media

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

Commercial / Technical Support:
8008193336 (for telephone)
4006203333 (for mobile)

Order / Customer Service Email:
ordercn@merckgroup.com

Sigma-Aldrich BioReliance Millipore SAFC Milli-Q Supelco

Reproduction of any materials from the site is strictly forbidden without permission.

TRC Clone ID	Validation	Gene Symbol	Gene ID	Ref Seq	Species	Region
TRCN0000003821		BTG1	694	NM_001731	Human	3UTR
Target Sequence: TGGCACAAGATAGAATGGTAA				Cell Type: -
Gene Synonym: -				Method: -
				Knockdown: -
				Version: 1
TRCN0000003822		BTG1	694	NM_001731	Human	CDS
Target Sequence: TCATCTCCAAGTTTCTCCGCA				Cell Type: -
Gene Synonym: -				Method: -
				Knockdown: -
				Version: 1
TRCN0000003823		BTG1	694	NM_001731	Human	CDS
Target Sequence: TGCAAATGGTAGACAGCCGAA				Cell Type: -
Gene Synonym: -				Method: -
				Knockdown: -
				Version: 1
TRCN0000003824	Validated	BTG1	694	NM_001731	Human	CDS
Target Sequence: CGCCGTGTCCTTCATCTCCAA				Cell Type: A549
Gene Synonym: -				Method: SYBR
				Knockdown: 70%
				Version: 1
TRCN0000003825		BTG1	694	NM_001731	Human	CDS
Target Sequence: GCAAATGGTAGACAGCCGAAT				Cell Type: -
Gene Synonym: -				Method: -
				Knockdown: -
				Version: 1
TRCN0000055298		BTG1	12226	NM_007569	Mouse	CDS
Target Sequence: CCGTTGTATTCGCATCAACCA				Cell Type: -
Gene Synonym: -				Method: -
				Knockdown: -
				Version: 1
TRCN0000055299		BTG1	12226	NM_007569	Mouse	CDS
Target Sequence: GCAAGGGATCAGGTTACCGTT				Cell Type: -
Gene Synonym: -				Method: -
				Knockdown: -
				Version: 1
TRCN0000055300	Validated	BTG1	12226	NM_007569	Mouse	CDS
Target Sequence: CGGTGTCCTTCATCTCCAAGT				Cell Type: Hepa 1-6
Gene Synonym: -				Method: SYBR
				Knockdown: 70%
				Version: 1
TRCN0000055301		BTG1	12226	NM_007569	Mouse	CDS
Target Sequence: CATAAGATGGATCCTCTGATT				Cell Type: -
Gene Synonym: -				Method: -
				Knockdown: -
				Version: 1
TRCN0000055302		BTG1	12226	NM_007569	Mouse	CDS
Target Sequence: CAGAACATTACAAACATCACT				Cell Type: -
Gene Synonym: -				Method: -
				Knockdown: -
				Version: 1

Predesigned shRNA

Help

tscn@merckgroup.com

800-819-3336

Search Query & Criteria

Species

TRC Version

Validation

Search Terms

Select shRNA Clones